Gene name |
SPAC6B12.10c |
Gene ID |
23/C12 |
Gene synonyms/obsolete |
pri1 |
Gene product |
DNA primase small
subunit; DNA primase activity; involved in telomere
maintenance |
Entry clone |
Cloned |
ORF length (unspliced) |
1449 |
ORF length (spliced) |
1365 |
Entry clone length |
1449 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
84A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC6B12.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGTTCAAATCGATGA |
Rev primer name |
SPAC6B12.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATTCCAAATTCTCATGT |
Amino acid length |
454 |
Molecular weight |
52 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHPHLTRSLNI |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |