| Gene name |
SPAC1952.01 |
| Gene ID |
23/D09 |
| Gene synonyms/obsolete |
SPAC1B3.19 |
| Gene product |
GPI-anchor
transamidase complex (5th subunit); involved in GPI anchor
biosynthesis; eukaryotic conserved protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1454 |
| ORF length (spliced) |
1227 |
| Entry clone length |
1454 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1952.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATACCAAATGAGAAGCT |
| Rev primer name |
SPAC1952.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGAACCTGTTTTAATGGA |
| Amino acid length |
408 |
| Molecular weight |
46.6 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKLLGLLSI |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |