| Gene name |
SPBC428.08c |
| Gene ID |
23/G02 |
| Gene synonyms/obsolete |
clr4 |
| Gene product |
histone H3
methyltransferase; involved in chromatin silencing; involved
in chromatin silencing at silent mating type cassettes (sensu
Fungi) (required); involved in chromatin silencing at
centromere; SET domain; chromodomain protein; methylates
histone H3 LYS9 to create a binding site for Swi6p;
non-essential; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1473 |
| ORF length (spliced) |
|
| Entry clone length |
1473 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
727T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC428.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGCCTAAACAAGAGGA |
| Rev primer name |
SPBC428.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCGAAAAGCCAGCCACGA |
| Amino acid length |
490 |
| Molecular weight |
55.9 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB?; nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |