| Gene name |
SPBC15D4.10c |
| Gene ID |
24/A05 |
| Gene synonyms/obsolete |
|
| Gene product |
nuclear rim protein;
required for the correct termination of microtubule growth at
cell ends in interphase; zinc finger protein; zf-CCCH type;
similar to A. thaliana f1b16.12; no apparent S.
cerevisiae ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1488 |
| ORF length (spliced) |
1428 |
| Entry clone length |
1488 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
101A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC15D4.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTCGTTTGTAAGTATTT |
| Rev primer name |
SPBC15D4.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACAAAATTGTGGTGGAGGG |
| Amino acid length |
475 |
| Molecular weight |
51.7 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots |
| Comments for localization |
a lot of moving
dots |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |