| Gene name |
SPBP8B7.11 |
| Gene ID |
24/A07 |
| Gene synonyms/obsolete |
|
| Gene product |
RNA-binding protein;
NTF2 domain; involved in nuclear cytoplasmic transport; rrm
RNA recognition motif; Ras GTPase activating protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1489 |
| ORF length (spliced) |
1305 |
| Entry clone length |
1489 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
19A:C / 256A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP8B7.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGCGGAAAATGCCAC |
| Rev primer name |
SPBP8B7.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTATTTTGCTTTTTAGAA |
| Amino acid length |
434 |
| Molecular weight |
47.9 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
Confocal |