| Gene name |
SPAC18B11.01c |
| Gene ID |
24/A09 |
| Gene synonyms/obsolete |
SPAC12G12.16c |
| Gene product |
XP-G family; involved
in nucleotide-excision repair; involved in DNA repair;
exonuclease; no apparent Sc ortholog; Sp specific
duplication |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1491 |
| ORF length (spliced) |
|
| Entry clone length |
1491 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
28A:G / 910T:A /
1062T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC18B11.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCGTTCATGGTTTGCT |
| Rev primer name |
SPAC18B11.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATACTCGTACGTGCTTTTG |
| Amino acid length |
496 |
| Molecular weight |
57.7 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEFILSNLDL/LKIIKGILTL/LNDNFHLPLQI |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |