| Gene name |
SPAC3F10.04 |
| Gene ID |
24/C01 |
| Gene synonyms/obsolete |
gsa1; gsh2 |
| Gene product |
glutathione
synthetase; involved in glutamate metabolism; involved in
glutathione biosynthesis; involved in cadmium resistance;
involved in phytochelatin synthesis; functionally complemeted
by A. thaliana gsh2; subunit data; expression regulated by the
Atf1-Spc1-Wis1 signaling pathway |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1497 |
| ORF length (spliced) |
|
| Entry clone length |
1497 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
183G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3F10.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAATTGAGAAGTATAC |
| Rev primer name |
SPAC3F10.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCAGAAAGTTCAATACTA |
| Amino acid length |
498 |
| Molecular weight |
56.1 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |