| Gene name |
SPCC1620.02 |
| Gene ID |
24/C07 |
| Gene synonyms/obsolete |
wtf23; wtf10 |
| Gene product |
wtf element |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1498 |
| ORF length (spliced) |
1107 |
| Entry clone length |
1498 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
145T:C / 1322T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1620.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAATAAATATTACCC |
| Rev primer name |
SPCC1620.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACTTCGCCTTCGACATCC |
| Amino acid length |
368 |
| Molecular weight |
41.1 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFIMGNVLFL |
| Localization (YFP) |
Golgi? |
| Comments for localization |
large aggregates by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |