| Gene name |
SPBC83.08 |
| Gene ID |
24/C09 |
| Gene synonyms/obsolete |
|
| Gene product |
AAA family ATPase;
chromatin remodeling complex; involved in chromatin
remodeling; (old->putative tata binding
protein-interacting) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1499 |
| ORF length (spliced) |
1398 |
| Entry clone length |
1499 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC83.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGATTTCGGTGACTTC |
| Rev primer name |
SPBC83.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTTCCTGCATTGCAACT |
| Amino acid length |
465 |
| Molecular weight |
51.5 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |