| Gene name |
SPAC664.08c |
| Gene ID |
24/D11 |
| Gene synonyms/obsolete |
|
| Gene product |
protein transport
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1508 |
| ORF length (spliced) |
1359 |
| Entry clone length |
1508 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
437A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC664.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAAAGGTAAGTTCAA |
| Rev primer name |
SPAC664.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCGAAGAGAGAAAATCCG |
| Amino acid length |
452 |
| Molecular weight |
51.5 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEDMKKGLAL/LVSFIQHTLQL |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |