Gene name |
SPBC30D10.17c |
Gene ID |
24/E11 |
Gene synonyms/obsolete |
|
Gene product |
glucan synthase
regulator; involved in beta-1,3 glucan biosynthesis; involved
in cell wall organization and biogenesis; similar to N. crassa
GS-1 |
Entry clone |
Cloned# |
ORF length (unspliced) |
1515 |
ORF length (spliced) |
|
Entry clone length |
1515 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC30D10.17.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGAAAAATTCGTTTTC |
Rev primer name |
SPBC30D10.17.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCTTGCTTCACACTTGTA |
Amino acid length |
504 |
Molecular weight |
55.5 |
Isoelectric point (calc.) |
4.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPRDVRESLYI/LFGVTLLDI |
Localization (YFP) |
periphery; periphery
at site of septum formation |
Comments for localization |
large aggregates by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |