| Gene name |
SPAC22G7.09c |
| Gene ID |
24/H07 |
| Gene synonyms/obsolete |
|
| Gene product |
nucleoporin; nuclear
pore complex; involved in nuclear export of the small
ribosomal subunit |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1538 |
| ORF length (spliced) |
1278 |
| Entry clone length |
1538 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
140A:G / 1526C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22G7.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCGGGTTAAATAAAAC |
| Rev primer name |
SPAC22G7.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTTATAAAGGGCAAGGAC |
| Amino acid length |
425 |
| Molecular weight |
44.9 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSVSTALLI |
| Localization (YFP) |
nuclear envelope;
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |