Gene name |
SPBC106.10 |
Gene ID |
24/H10 |
Gene synonyms/obsolete |
pka1; tpk; git6 |
Gene product |
cAMP-dependent protein
kinase (catalytic subunit); serine/threonine protein kinase;
involved in conjugation (regulation) (negative); involved in
the regulation of meiosis (negative); involved in protein
amino acid phosphorylation (of Mei3p); overexpression results
in cell cycle defects; non-essential |
Entry clone |
Cloned/2003.08 |
ORF length (unspliced) |
1539 |
ORF length (spliced) |
|
Entry clone length |
1539 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1376T:C |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC106.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATACGACTGCCGTTGC |
Rev primer name |
SPBC106.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAGTCCTTAAAGATAGAA |
Amino acid length |
512 |
Molecular weight |
57.5 |
Isoelectric point (calc.) |
7.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLDRFGHLKI |
Localization (YFP) |
cytosol=nucleus;
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |