Gene name |
SPAC9E9.10c |
Gene ID |
25/A09 |
Gene synonyms/obsolete |
cbh1; cbh |
Gene product |
centromere k-type
repeat binding protein; CENP-B homolog; involved in chromosome
segregation; CENP-B box; C-terminal dimerization domain;
disruption of CENP-B homologs causes a decrease in
heterochromatin-specific modifications of histone H3; Sp
CENP-B homologs are functionally redundant at centromeres;
CENP-B homologs act as site-specific nucleation factors for
the formation of centromeric heterochromatin by
heterochromatin-specific modifications of histone tails |
Entry clone |
Cloned |
ORF length (unspliced) |
1545 |
ORF length (spliced) |
|
Entry clone length |
1545 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC9E9.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTCCTATACGCCAGGC |
Rev primer name |
SPAC9E9.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACGCTATTAAATTATTAGGG |
Amino acid length |
514 |
Molecular weight |
59.8 |
Isoelectric point (calc.) |
7.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; nuclear dots;
spindle microtubules |
Comments for localization |
1~2 dots/nucleus |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |