Gene name |
SPAC227.07c |
Gene ID |
25/B10 |
Gene synonyms/obsolete |
pab1 |
Gene product |
protein phosphatase
pp2a regulatory subunit b; involved in cellular morphogenesis;
involved in cell wall biosynthesis; involved in cytokinesis;
WD repeat protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1556 |
ORF length (spliced) |
1392 |
Entry clone length |
1556 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
472G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC227.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGATATAGAAGACTC |
Rev primer name |
SPAC227.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAGCTTAGAGAAAACAAAA |
Amino acid length |
463 |
Molecular weight |
52.7 |
Isoelectric point (calc.) |
5.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRINLWNLSI |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |