| Gene name |
SPBC1778.04 |
| Gene ID |
25/C09 |
| Gene synonyms/obsolete |
spo6 |
| Gene product |
involved in meiosis II
(required); involved in sporulation (required); similar to Sp
dfp1; BRCT domain; Spo4p regulatory subunit; involved in
ascospore formation (required); essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1568 |
| ORF length (spliced) |
1425 |
| Entry clone length |
1568 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
915A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1778.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACTTCTATTCAGTGAA |
| Rev primer name |
SPBC1778.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTGTCCGAATTGGGCGT |
| Amino acid length |
474 |
| Molecular weight |
54.7 |
| Isoelectric point (calc.) |
9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |