| Gene name |
SPAC2F7.17 |
| Gene ID |
25/C12 |
| Gene synonyms/obsolete |
|
| Gene product |
peptide chain release
factor |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1570 |
| ORF length (spliced) |
1191 |
| Entry clone length |
1570 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
506T:addition / 535A:G
/ 1160G:A / 1504C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC2F7.17.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTCTAACTAAAAAAGT |
| Rev primer name |
SPAC2F7.17.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATACTATTTCAGAGTGTAAT |
| Amino acid length |
396 |
| Molecular weight |
44.9 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
a few dots |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |