Gene name |
SPBC3D6.07 |
Gene ID |
25/D03 |
Gene synonyms/obsolete |
|
Gene product |
transferase activity,
transferring hexosyl groups; glycosyl transferases group 1;
involved in GPI anchor biosynthesis (early step) |
Entry clone |
Cloned |
ORF length (unspliced) |
1572 |
ORF length (spliced) |
1371 |
Entry clone length |
1572 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
849T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3D6.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTATCAGACTTCTTCTT |
Rev primer name |
SPBC3D6.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTGTGCATCTTTTAAACAT |
Amino acid length |
456 |
Molecular weight |
51.7 |
Isoelectric point (calc.) |
7.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRLIDRLKL |
Localization (YFP) |
ER; cytoplasmic
dots |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |