| Gene name |
SPAC222.12c |
| Gene ID |
25/D07 |
| Gene synonyms/obsolete |
atp2 |
| Gene product |
F1-ATPase (beta
subunit); ATP synthesis coupled proton transport; functionally
complemented by Sc ATP2 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1578 |
| ORF length (spliced) |
|
| Entry clone length |
1578 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
280T:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC222.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTAAAGAAACAGGCCCT |
| Rev primer name |
SPAC222.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCAGCCAATTCTTGTGCA |
| Amino acid length |
525 |
| Molecular weight |
56.8 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSRSISELGI |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |