| Gene name |
SPAC1B3.09c |
| Gene ID |
25/E09 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in ribosome
biogenesis and assembly; involved in ribosome nucleus export;
similar to Sp SPAC1142.04; predicted coiled-coil region |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1587 |
| ORF length (spliced) |
|
| Entry clone length |
1587 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
301A:C / 1280G:T /
1468G:A / 1499T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1B3.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAAAGCTTCCAAGGC |
| Rev primer name |
SPAC1B3.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGTAGTATCACTGACTAGT |
| Amino acid length |
528 |
| Molecular weight |
60.7 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSALDTILHI/LQLFLIELLSL |
| Localization (YFP) |
nucleolus>>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |