Gene name |
SPAC3G6.06c |
Gene ID |
25/F04 |
Gene synonyms/obsolete |
rad2; fen1 |
Gene product |
FEN-1 endonuclease;
involved in Okazaki fragment processing; involved in DNA
replication; involved in DNA repair; Uve1p dependent repair;
XP-G family; deletion mutant hypersensitive to MMS; involved
in telomere maintenance |
Entry clone |
Cloned |
ORF length (unspliced) |
1593 |
ORF length (spliced) |
1143 |
Entry clone length |
1593 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
655T:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3G6.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAATTAAAGGTATGTT |
Rev primer name |
SPAC3G6.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGCTTTTTCTTGCTTTCA |
Amino acid length |
380 |
Molecular weight |
42.8 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
365 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMGMFYRTLRI |
Localization (YFP) |
nucleus |
Comments for localization |
faint signal of
mitochondrion |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |