Gene name |
SPCC1235.13 |
Gene ID |
25/G09 |
Gene synonyms/obsolete |
ght6; meu12 |
Gene product |
meiotic expression
upregulated; hexose transporter; similar to Sp GHT1 and GHT2
and GHT4 and GHT5 and GHT3 and SPCC548.06C and SPBC1348.14C;
tandem duplication |
Entry clone |
Cloned |
ORF length (unspliced) |
1608 |
ORF length (spliced) |
|
Entry clone length |
1608 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
352A:G / 1125T:C /
1158T:C / 1230T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1235.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGAAAATCTTAACCAT |
Rev primer name |
SPCC1235.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAAGCCAACCGGATTGGTG |
Amino acid length |
535 |
Molecular weight |
59.4 |
Isoelectric point (calc.) |
8.4 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
10 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMFFGMLFL/LNSPFLAALIL/LEEINQLYL |
Localization (YFP) |
periphery at cell tip
and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |