Gene name |
SPAC17A5.04c |
Gene ID |
25/G12 |
Gene synonyms/obsolete |
|
Gene product |
zinc metallopeptidase;
disintegrin/ADAM protease; GPI anchored protein (pers. comm.
Birgit Eisenhaber); glycoprotein; non-essential; no apparent
Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1610 |
ORF length (spliced) |
1539 |
Entry clone length |
1610 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
1329T:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC17A5.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGGCTCGTTTTACTGTT |
Rev primer name |
SPAC17A5.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCAGAAAAACCATGCTATT |
Amino acid length |
512 |
Molecular weight |
56.4 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFPALQTLWI |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |