| Gene name |
SPBC4F6.10 |
| Gene ID |
25/H02 |
| Gene synonyms/obsolete |
vps901; vps9a |
| Gene product |
guanyl-nucleotide
exchange factor activity; involved in intracellular protein
transport; CUE domain protein (inferred from context);
involved in endocytosis; involved in protein-vacuolar
targeting |
| Entry clone |
Cloned#/Sequence
mismatch |
| ORF length (unspliced) |
1614 |
| ORF length (spliced) |
|
| Entry clone length |
1614 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1339C:addition |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC4F6.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTATCCATCATTTCA |
| Rev primer name |
SPBC4F6.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGCCGTAATTGCTTCAGC |
| Amino acid length |
537 |
| Molecular weight |
62.5 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LENMKYLQI/LIVALSQLIL/LVHIPRLLPI/LGKRLKQLRL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |