Gene name |
SPAC458.02c |
Gene ID |
26/A02 |
Gene synonyms/obsolete |
|
Gene product |
involved in mitosis;
involved in cytokinesis; involved in meiosis; involved in
spindle assembly |
Entry clone |
Cloned |
ORF length (unspliced) |
1624 |
ORF length (spliced) |
1407 |
Entry clone length |
1624 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
1178C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC458.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATCTCATAAACCCGT |
Rev primer name |
SPAC458.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCTGTAGCTTCCACCTCC |
Amino acid length |
468 |
Molecular weight |
53.7 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |