Gene name |
SPBC15C4.04c |
Gene ID |
26/A08 |
Gene synonyms/obsolete |
|
Gene product |
amino acid permease
family; similar to Sp SPAPB24D3.02C and SPCC74.04 and
SPAC1039.01 and SPAC11D3.08C and SPCC584.13 and SPAC9.10 and
SPCC794.03 |
Entry clone |
Cloned |
ORF length (unspliced) |
1629 |
ORF length (spliced) |
|
Entry clone length |
1629 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1098T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC15C4.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCGGTTTCTAACGT |
Rev primer name |
SPBC15C4.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCAGTTTTGAATGGATCC |
Amino acid length |
542 |
Molecular weight |
59.7 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
11 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNVVFCIALNL |
Localization (YFP) |
Golgi; periphery at
cell tip and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |