| Gene name |
SPBC9B6.11c |
| Gene ID |
26/B05 |
| Gene synonyms/obsolete |
|
| Gene product |
cr4p-like; RNA
nuclease; involved in RNA processing; involved in 3' end
processing of 5.8S rRNA (final step) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1638 |
| ORF length (spliced) |
1509 |
| Entry clone length |
1638 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC9B6.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTACACTTGTCCTAAAAC |
| Rev primer name |
SPBC9B6.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACAATTTGTACATTTGCC |
| Amino acid length |
502 |
| Molecular weight |
57.6 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFKKVQDLTI |
| Localization (YFP) |
cytosol=nucleus; a few
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |