| Gene name |
SPAC2G11.03c |
| Gene ID |
26/C08 |
| Gene synonyms/obsolete |
vps45 |
| Gene product |
sec1 family; SNARE
binding activity; SNARE docking complex (TRAPP?); involved in
non-selective vesicle docking; syntaxin binding protein;
involved in intracellular protein transport; involved in
secretory pathway; involved in exocytosis; involved in
non-selective vesicle docking; involved in ER to golgi
transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1864 |
| ORF length (spliced) |
1677 |
| Entry clone length |
1864 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1790T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC2G11.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTAGTATCAGCTTC |
| Rev primer name |
SPAC2G11.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTATTCTGGTTGACATA |
| Amino acid length |
558 |
| Molecular weight |
63.5 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol;
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |