Gene name |
SPBC428.17c |
Gene ID |
26/E06 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical
serine-rich protein; sequence orphan; non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
1894 |
ORF length (spliced) |
1809 |
Entry clone length |
1894 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
1592A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC428.17.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAAGAGGAAAATGTAA |
Rev primer name |
SPBC428.17.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTACCAAGTCACTGCGC |
Amino acid length |
602 |
Molecular weight |
67.5 |
Isoelectric point (calc.) |
5.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFTELINLLI/LIILILGLLL |
Localization (YFP) |
nucleus;
mitochondrion |
Comments for localization |
faint signal of
mitochondrion |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |