| Gene name |
SPAC22E12.10c |
| Gene ID |
26/E08 |
| Gene synonyms/obsolete |
etp1; cox15 |
| Gene product |
electron transfer
protein; ferredoxin; involved in cytochrome c oxidase
biognesis; overexpression enhances steroid hydroxylase
activity of human CYP11B2 expressing Sp cells; includes 2Fe-2S
iron-sulfur cluster binding domain absent from Sc COX15 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1896 |
| ORF length (spliced) |
|
| Entry clone length |
1896 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22E12.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACATTTCACGTTCATC |
| Rev primer name |
SPAC22E12.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCTTTTGGTCTCTCCAAT |
| Amino acid length |
631 |
| Molecular weight |
70.1 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVTLTAALSL |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |