| Gene name |
SPAC26H5.07c |
| Gene ID |
26/E10 |
| Gene synonyms/obsolete |
|
| Gene product |
similar to the
transmembrane region of mannosyltransferases; similar to Sp
SPBC18A7.02c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1898 |
| ORF length (spliced) |
1518 |
| Entry clone length |
1898 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1214T:C /
1634T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC26H5.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGATTTTAAAGTCGGC |
| Rev primer name |
SPAC26H5.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAGGCTTTTGCTTAGAA |
| Amino acid length |
505 |
| Molecular weight |
56.8 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
8 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LITLFAMFLWI/LNNTIRDLRI/LVLILMLTI |
| Localization (YFP) |
cytoplasmic dots;
Golgi?; ER |
| Comments for localization |
bright dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |