| Gene name |
SPCC1795.11 |
| Gene ID |
26/F10 |
| Gene synonyms/obsolete |
sum3; ded1; slh3;
moc2 |
| Gene product |
DEAD/DEAH box
helicase; ATP-dependent RNA helicase; involved in translation
initiation; essential; suppressor of uncontrolled mitosis;
interacts physically with Chk1p; interacts physically with
Cdc2p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1911 |
| ORF length (spliced) |
|
| Entry clone length |
1911 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
105T:C / 1366C:T /
1659T:C / 1838A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1795.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCGACAATGTACAGCA |
| Rev primer name |
SPCC1795.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCACCAGGATTGAGCACTA |
| Amino acid length |
636 |
| Molecular weight |
69.7 |
| Isoelectric point (calc.) |
8.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LANIKFLVL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
DeltaVision |