| Gene name |
SPCC320.10 |
| Gene ID |
26/G04 |
| Gene synonyms/obsolete |
srp72 |
| Gene product |
TPR repeat protein;
protein signal sequence binding activity; involved in
intracellular protein transport; involved in protein-ER
targeting; involved in SRP-dependent cotranslational membrane
targeting |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1919 |
| ORF length (spliced) |
1686 |
| Entry clone length |
1919 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1367A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC320.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAACCACGAAGAGGA |
| Rev primer name |
SPCC320.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCAACACCACCTTGCATG |
| Amino acid length |
561 |
| Molecular weight |
63.2 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSDFSKALKI |
| Localization (YFP) |
nuclear dots;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |