Gene name |
SPAC22E12.14c |
Gene ID |
26/H06 |
Gene synonyms/obsolete |
|
Gene product |
serine/threonine
protein kinase; similar to Sp sck1 (paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
1941 |
ORF length (spliced) |
|
Entry clone length |
1941 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC22E12.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGAATAAGTGGGCAAA |
Rev primer name |
SPAC22E12.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGGATCTATTTGTCCCATA |
Amino acid length |
646 |
Molecular weight |
71.8 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKLQIGSLVL |
Localization (YFP) |
ambiguous structure;
periphery; nuclear envelope; cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |