| Gene name |
SPCC1020.10 |
| Gene ID |
27/A04 |
| Gene synonyms/obsolete |
oca2 |
| Gene product |
serine/threonine
protein kinase; overexpression results in cell cycle
defects |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1953 |
| ORF length (spliced) |
|
| Entry clone length |
1953 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
574A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1020.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGTCACCCCTCCCAA |
| Rev primer name |
SPCC1020.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGCTTTGCAGGTGGAGCA |
| Amino acid length |
650 |
| Molecular weight |
73.2 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LENKLDTELKI |
| Localization (YFP) |
periphery at site of
septum formation and cell tip; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
Zeiss |