Gene name |
SPBC11C11.03 |
Gene ID |
27/B05 |
Gene synonyms/obsolete |
ndc10; tid3 |
Gene product |
involved in chromosome
segregation; predicted coiled-coil regions; spindle pole body
protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1967 |
ORF length (spliced) |
1875 |
Entry clone length |
1967 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC11C11.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAGATTCTTCCTCTTA |
Rev primer name |
SPBC11C11.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAGTTCCGAACGAGATAGG |
Amino acid length |
624 |
Molecular weight |
71.8 |
Isoelectric point (calc.) |
5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LESGFSQPLGL/LERELQQLKL |
Localization (YFP) |
SPB |
Comments for localization |
cytoplasmic dots by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |