Gene name |
SPCC1682.05c |
Gene ID |
27/B11 |
Gene synonyms/obsolete |
|
Gene product |
TPR repeat protein;
localization signal recognition particle; involved in
protein-ER targeting |
Entry clone |
Cloned |
ORF length (unspliced) |
1970 |
ORF length (spliced) |
1794 |
Entry clone length |
1970 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
460A:G / 972A:G /
1748T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1682.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACCCGCATGTTAAGCT |
Rev primer name |
SPCC1682.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCGTCCAAGCAAACTGCTA |
Amino acid length |
597 |
Molecular weight |
67.8 |
Isoelectric point (calc.) |
7.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAYNVVLLRI |
Localization (YFP) |
cytosol; ambiguous
structure |
Comments for localization |
nuclear envelope?,
periphery? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|