| Gene name |
SPAC22A12.15c |
| Gene ID |
27/C11 |
| Gene synonyms/obsolete |
bip1; bip |
| Gene product |
resident luminal ER
protein; essential; heat shock protein 70 family; involved in
assembly of multimeric complexes in the ER; interacts
physically with Cnx1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1992 |
| ORF length (spliced) |
|
| Entry clone length |
1992 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
12C:G / 1235A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22A12.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAAGTTCCAGCTATT |
| Rev primer name |
SPAC22A12.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGTTCATCGGCCTCATCA |
| Amino acid length |
663 |
| Molecular weight |
73.2 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSYFVALFL/LLDVIPLTLGI |
| Localization (YFP) |
ER; Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |