Gene name |
SPAC29A4.08c |
Gene ID |
27/D01 |
Gene synonyms/obsolete |
prp19; cwf8 |
Gene product |
ubiquitin-protein
ligase (E4); involved in mRNA splicing; WD repeat
protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1992 |
ORF length (spliced) |
1467 |
Entry clone length |
1992 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC29A4.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTTGCTCAATCAGTGG |
Rev primer name |
SPAC29A4.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACCCAACCGGAGAATGGCT |
Amino acid length |
488 |
Molecular weight |
54.1 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol;
nuclear envelope?; a few cytoplasmic dots |
Comments for localization |
one nuclear dot by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |