| Gene name |
SPAC23A1.01c |
| Gene ID |
27/E01 |
| Gene synonyms/obsolete |
SPAC19G12.16c |
| Gene product |
Sp specific;
serine/threonine-rich protein; glycoprotein; similar to alpha
agglutinins; localization cell surface; GPI anchored
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2013 |
| ORF length (spliced) |
|
| Entry clone length |
2013 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23A1.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGAAGATTAACCATCAG |
| Rev primer name |
SPAC23A1.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAATAAAAACAATAAAGGG |
| Amino acid length |
670 |
| Molecular weight |
68.2 |
| Isoelectric point (calc.) |
4.2 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLCVFIPLLFL |
| Localization (YFP) |
ER, only? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|