| Gene name |
SPAC23C4.18c |
| Gene ID |
27/F12 |
| Gene synonyms/obsolete |
rad4; cut5 |
| Gene product |
involved in DNA
replication checkpoint, S-M checkpoint control; DNA polymerase
(epsilon subunit) |
| Entry clone |
Cloned#/ 3' FS |
| ORF length (unspliced) |
2070 |
| ORF length (spliced) |
1947 |
| Entry clone length |
2070 |
| No. of intron |
2 |
| Sequence status |
planning for
re-cloning |
| Sequence results |
2062A:deletion |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23C4.18.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTTCTTCTAAACCACT |
| Rev primer name |
SPAC23C4.18.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGCCTACGGAGTTTTCGA |
| Amino acid length |
648 |
| Molecular weight |
74.1 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVPYFNGLSI/LSHLKKALTI |
| Localization (YFP) |
SPB; nucleus; spindle
microtubules; nucleus>cytosol during anaphase |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus; nuclear dots) |
| Microscope used for
observation |
DeltaVision |