Gene name |
SPAC4D7.13 |
Gene ID |
27/G08 |
Gene synonyms/obsolete |
prp40 |
Gene product |
involved in mRNA
splicing; WW domain; U1 snRNA-associated protein; formin
binding protein |
Entry clone |
Cloned |
ORF length (unspliced) |
2088 |
ORF length (spliced) |
|
Entry clone length |
2088 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC4D7.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGCACCTCCATGGCA |
Rev primer name |
SPAC4D7.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGAATTTCACCTTCTTCA |
Amino acid length |
695 |
Molecular weight |
81.9 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
599 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDCLEVLQI |
Localization (YFP) |
nucleus; a few nuclear
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |