| Gene name |
SPAC13G7.04c |
| Gene ID |
28/B08 |
| Gene synonyms/obsolete |
mac1 |
| Gene product |
membrane anchored
protein; similar to Sp SPCC1739.10; involved in cell
separation (required at high temperatures); possibly fungal
specific |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2271 |
| ORF length (spliced) |
|
| Entry clone length |
2271 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1766T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC13G7.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTCGCAATACTTTAGC |
| Rev primer name |
SPAC13G7.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGGATCATCCGATTTCCA |
| Amino acid length |
756 |
| Molecular weight |
81.7 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
3 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAFLAILFL/LAFAIELVLFL/LIAILALCL |
| Localization (YFP) |
periphery at cell tip
and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |