Gene name |
SPBC1706.03 |
Gene ID |
28/B10 |
Gene synonyms/obsolete |
SPBC839.01 |
Gene product |
putative GTPase;
GTP-binding protein; possibly involved in mitochondrial
fusion; involved in mitochondrial DNA (maintenance) |
Entry clone |
Cloned |
ORF length (unspliced) |
2277 |
ORF length (spliced) |
|
Entry clone length |
2277 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1589C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1706.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGAAGAGTGCAAGGCA |
Rev primer name |
SPBC1706.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATAATTTATATCACATCCC |
Amino acid length |
758 |
Molecular weight |
87.1 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSGLVGDILNI/LQKHFRFELGL/LQHLLVPVLGL |
Localization (YFP) |
ambiguous
structure |
Comments for localization |
ambiguous structure
near nucleus |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |