| Gene name |
SPCC4G3.19 |
| Gene ID |
28/B12 |
| Gene synonyms/obsolete |
alp19 |
| Gene product |
gamma tubulin complex;
overexpression suppresses an alp6 ts mutant; overexpression
lethal; deletion mutant sensitive to microtubule
depolymerizing drugs; deletion mutant results in abnormally
long cytoplasmic microtubules; similar to H. sapiens hGPC6; no
apparent S. cerevisiae ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2280 |
| ORF length (spliced) |
|
| Entry clone length |
2280 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1725T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC4G3.19.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGGAATTATGAAAAA |
| Rev primer name |
SPCC4G3.19.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGACACTTTGATGGATGAC |
| Amino acid length |
759 |
| Molecular weight |
87.2 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |