| Gene name |
SPCC830.03 |
| Gene ID |
28/C02 |
| Gene synonyms/obsolete |
|
| Gene product |
eukaryotic conserved
protein; Sc YLL035W is null lethal; Sc YLL035W is predicted to
interact with LAS1; involved in cell growth; ATP/GTP-binding
(prosite) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2288 |
| ORF length (spliced) |
2211 |
| Entry clone length |
2288 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
85G:A / 277T:A /
1400C:T / 1435C:T / 1495C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC830.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTCAAGCGTCAACGTAT |
| Rev primer name |
SPCC830.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCAACGAAAGTACTACGA |
| Amino acid length |
736 |
| Molecular weight |
83.2 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |