Gene name |
SPBC887.03c |
Gene ID |
28/C04 |
Gene synonyms/obsolete |
|
Gene product |
basic helix-loop-helix
(bHLH); involved in DNA replication; NucleOlar Complex 2;
involved in nuclear export of pre-ribosomes; interacts with
MCM proteins; involved in the establishment and maintenance of
pre-replication complexes; conserved eukaryotic protein |
Entry clone |
Cloned |
ORF length (unspliced) |
2289 |
ORF length (spliced) |
2244 |
Entry clone length |
2289 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
648A:G / 1686A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC887.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGGCTCGGAAGAATCA |
Rev primer name |
SPBC887.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAACGAAGTGCTTTTTAAC |
Amino acid length |
747 |
Molecular weight |
85.1 |
Isoelectric point (calc.) |
8.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
442 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEPVENLHL/LPDVYDLFL/LSSFSKRLAI |
Localization (YFP) |
nucleolus>>nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |