| Gene name |
SPBC1703.04 |
| Gene ID |
28/C06 |
| Gene synonyms/obsolete |
mlh1 |
| Gene product |
mutL homolog; involved
in DNA repair; involved in mismatch repair |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2295 |
| ORF length (spliced) |
2055 |
| Entry clone length |
2295 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1760T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1703.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGTCAATTCACGAGC |
| Rev primer name |
SPBC1703.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACAACGTTCGAAAACATTA |
| Amino acid length |
684 |
| Molecular weight |
77.2 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol;
SPB? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |