Gene name |
SPAC17G6.05c |
Gene ID |
28/D03 |
Gene synonyms/obsolete |
|
Gene product |
endosome associated
protein; involved in intracellular protein transport; involved
in signal transduction; BRO1-like domain |
Entry clone |
Cloned |
ORF length (unspliced) |
2328 |
ORF length (spliced) |
|
Entry clone length |
2328 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
ApaI or SacII should
be used instead of NotI for integration using pDUAL. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC17G6.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGAAACTTGCTACTCC |
Rev primer name |
SPAC17G6.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGATGTGAAGGTTTCGCATA |
Amino acid length |
775 |
Molecular weight |
86.6 |
Isoelectric point (calc.) |
6.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLGIYNLFL/LQALPPLPL |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Confocal |