Gene name |
SPCP25A2.03 |
Gene ID |
28/E03 |
Gene synonyms/obsolete |
|
Gene product |
vertebrate p84
(retinoblastoma binding) orthologue; involved in RNA
processing; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
2373 |
ORF length (spliced) |
2259 |
Entry clone length |
2373 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCP25A2.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGTGCAAAAGGGTTT |
Rev primer name |
SPCP25A2.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAATACAATTTCTCCATCC |
Amino acid length |
752 |
Molecular weight |
85.2 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKCLFAILDL/LQAILQLII |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |